ID: 915735498_915735508

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 915735498 915735508
Species Human (GRCh38) Human (GRCh38)
Location 1:158082078-158082100 1:158082120-158082142
Sequence CCTCAAACCTGTCCCCATCTGGC CAGAACAAGGAGGAAGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 249} {0: 1, 1: 0, 2: 6, 3: 75, 4: 636}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!