ID: 915736237_915736241

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 915736237 915736241
Species Human (GRCh38) Human (GRCh38)
Location 1:158087382-158087404 1:158087404-158087426
Sequence CCTGGTAGGTGTGTAATAAATTG GTCTCTCCCCAGGGAACCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184} {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!