ID: 915736237_915736252

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 915736237 915736252
Species Human (GRCh38) Human (GRCh38)
Location 1:158087382-158087404 1:158087424-158087446
Sequence CCTGGTAGGTGTGTAATAAATTG GGGGGTGTGGGCAGCAACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184} {0: 1, 1: 0, 2: 4, 3: 55, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!