ID: 915781996_915782000

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 915781996 915782000
Species Human (GRCh38) Human (GRCh38)
Location 1:158562686-158562708 1:158562710-158562732
Sequence CCATCACTGTCTTCCTGAAGGCC CCTTCACCTCCTTGTTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 351} {0: 2, 1: 10, 2: 16, 3: 115, 4: 2623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!