ID: 915783334_915783338

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 915783334 915783338
Species Human (GRCh38) Human (GRCh38)
Location 1:158578945-158578967 1:158578980-158579002
Sequence CCATCATTCTTCTAAAAGCATTT TTCCTCAGGCTGAATATGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 514} {0: 1, 1: 0, 2: 9, 3: 48, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!