ID: 915849464_915849469

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 915849464 915849469
Species Human (GRCh38) Human (GRCh38)
Location 1:159305752-159305774 1:159305769-159305791
Sequence CCGAGAGGCTTTGTGGCCCCAGA CCCAGACTGACTTTTCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 244} {0: 1, 1: 0, 2: 1, 3: 11, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!