ID: 915870998_915871002 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 915870998 | 915871002 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:159559448-159559470 | 1:159559469-159559491 |
| Sequence | CCTCCCTCGATATGTGGGAATTA | TACAATTTGAGATGAGATTTGGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||