ID: 915885007_915885020

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 915885007 915885020
Species Human (GRCh38) Human (GRCh38)
Location 1:159713041-159713063 1:159713092-159713114
Sequence CCAGTGTCCTGATTCTGAGACTG TCCTGCTTTCTGGGGGTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188} {0: 1, 1: 2, 2: 0, 3: 15, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!