ID: 915905331_915905335

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 915905331 915905335
Species Human (GRCh38) Human (GRCh38)
Location 1:159872868-159872890 1:159872882-159872904
Sequence CCATGCTTTCCAGCCTGTGGTGC CTGTGGTGCCATCTCTTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 315} {0: 1, 1: 0, 2: 1, 3: 22, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!