ID: 915935786_915935798

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 915935786 915935798
Species Human (GRCh38) Human (GRCh38)
Location 1:160089619-160089641 1:160089671-160089693
Sequence CCCAAAGACGCATATTCTCACCC AGTCACCAGCGGCAGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 99, 4: 6030} {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!