ID: 915944484_915944490

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 915944484 915944490
Species Human (GRCh38) Human (GRCh38)
Location 1:160140004-160140026 1:160140024-160140046
Sequence CCCCAGCAAAGTGCAAGCCCCAC CACCACCAGCTCCTCCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 289} {0: 1, 1: 1, 2: 1, 3: 96, 4: 1187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!