|
Left Crispr |
Right Crispr |
| Crispr ID |
915956166 |
915956168 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:160221798-160221820
|
1:160221825-160221847
|
| Sequence |
CCTTCCTAATTCTAGGTCTCAAA |
AAAAAAAAAAAAAAAAGATAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 11, 4: 229} |
{0: 205, 1: 2898, 2: 38691, 3: 58734, 4: 106747} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|