ID: 915977560_915977569

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 915977560 915977569
Species Human (GRCh38) Human (GRCh38)
Location 1:160400849-160400871 1:160400874-160400896
Sequence CCCGGCAGTTCGCAGCGGCGGGT GTGCCGGGCCGCGGGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47} {0: 1, 1: 0, 2: 7, 3: 63, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!