|
Left Crispr |
Right Crispr |
| Crispr ID |
915978630 |
915978638 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:160406848-160406870
|
1:160406888-160406910
|
| Sequence |
CCTCCCGAATAGCTGGGATTACA |
CTGGCTAATTTTGCATTTTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1840, 1: 53371, 2: 229051, 3: 581163, 4: 434152} |
{0: 4, 1: 90, 2: 158, 3: 472, 4: 3611} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|