|
Left Crispr |
Right Crispr |
| Crispr ID |
915979448 |
915979467 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:160410880-160410902
|
1:160410931-160410953
|
| Sequence |
CCTCCATAACCTCCCTCCCTTTG |
CTGCCATCACCTAGGCAACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 34, 4: 393} |
{0: 1, 1: 0, 2: 1, 3: 10, 4: 159} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|