ID: 916001522_916001527

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 916001522 916001527
Species Human (GRCh38) Human (GRCh38)
Location 1:160621101-160621123 1:160621121-160621143
Sequence CCTTTGTATACATCATGCAGCAG CAGTAAGGATGGTGGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127} {0: 1, 1: 0, 2: 3, 3: 43, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!