ID: 916002629_916002635

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 916002629 916002635
Species Human (GRCh38) Human (GRCh38)
Location 1:160631594-160631616 1:160631618-160631640
Sequence CCCCTAATCTAACCTAACTGGTG CCTTATAAGAAGAGGAAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 203} {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!