|
Left Crispr |
Right Crispr |
| Crispr ID |
916002631 |
916002635 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:160631596-160631618
|
1:160631618-160631640
|
| Sequence |
CCTAATCTAACCTAACTGGTGTC |
CCTTATAAGAAGAGGAAATCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 50, 3: 291, 4: 1023} |
{0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|