ID: 916031482_916031488

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 916031482 916031488
Species Human (GRCh38) Human (GRCh38)
Location 1:160881197-160881219 1:160881227-160881249
Sequence CCAGTGTCCGTGCGGTACCTCAG CTGTTTCTCCAGTGCTGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 42} {0: 1, 1: 1, 2: 1, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!