ID: 916059203_916059208

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 916059203 916059208
Species Human (GRCh38) Human (GRCh38)
Location 1:161087248-161087270 1:161087282-161087304
Sequence CCCCAGAGCAACCTCAGCTCTGT CTGCTGCAGCAGCAGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 264} {0: 1, 1: 1, 2: 11, 3: 106, 4: 794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!