ID: 916091328_916091346

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 916091328 916091346
Species Human (GRCh38) Human (GRCh38)
Location 1:161309893-161309915 1:161309935-161309957
Sequence CCCCAGGAGCCATAGCTGGGGCA TCTGTGGGGTTGAGAAAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 41, 4: 280} {0: 1, 1: 0, 2: 2, 3: 24, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!