ID: 916113045_916113052

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 916113045 916113052
Species Human (GRCh38) Human (GRCh38)
Location 1:161468603-161468625 1:161468641-161468663
Sequence CCTGGAAGACAGCACCTGAGATG GATGACAGATACCCACGGGATGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 26, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!