ID: 916138561_916138569

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 916138561 916138569
Species Human (GRCh38) Human (GRCh38)
Location 1:161674543-161674565 1:161674587-161674609
Sequence CCAACTATATGACCCAAGTGAGT AGCTGTCTCAAGTGGAAAATGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 1, 2: 2, 3: 46, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!