ID: 916191405_916191410

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 916191405 916191410
Species Human (GRCh38) Human (GRCh38)
Location 1:162182064-162182086 1:162182080-162182102
Sequence CCATCTTCCTTCTTCATGTACTA TGTACTAGAGGAGGAAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 448} {0: 1, 1: 0, 2: 2, 3: 21, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!