ID: 916208490_916208493

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 916208490 916208493
Species Human (GRCh38) Human (GRCh38)
Location 1:162338594-162338616 1:162338628-162338650
Sequence CCAACCAACTACAAAGTCGTTAA GAAAATAAAATCATGGTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72} {0: 1, 1: 0, 2: 2, 3: 38, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!