ID: 916236368_916236379

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 916236368 916236379
Species Human (GRCh38) Human (GRCh38)
Location 1:162592831-162592853 1:162592871-162592893
Sequence CCTCCATACTAACTGGCATCGTA TTGGGGGTCTGGAGGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 78} {0: 1, 1: 0, 2: 11, 3: 119, 4: 1058}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!