ID: 916252558_916252562

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 916252558 916252562
Species Human (GRCh38) Human (GRCh38)
Location 1:162753267-162753289 1:162753298-162753320
Sequence CCCTAGGGGCTGGGGAAGGTGGT CAGGAACTGTTGAGAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 400} {0: 1, 1: 0, 2: 1, 3: 26, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!