ID: 916252736_916252749

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 916252736 916252749
Species Human (GRCh38) Human (GRCh38)
Location 1:162754596-162754618 1:162754632-162754654
Sequence CCTCTCTCCCCAACCCTCACCTC CAGAAGAAGGGGATGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 257, 4: 2252} {0: 1, 1: 0, 2: 2, 3: 61, 4: 1345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!