ID: 916275977_916275986

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 916275977 916275986
Species Human (GRCh38) Human (GRCh38)
Location 1:162993769-162993791 1:162993815-162993837
Sequence CCAGCCCAAACATCCCAGTTTCT CTCCCCCTCAAAGAGCTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 303} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!