ID: 916341773_916341775

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 916341773 916341775
Species Human (GRCh38) Human (GRCh38)
Location 1:163744942-163744964 1:163744956-163744978
Sequence CCTTCTCACTCTTCTCTCTTCTT TCTCTTCTTTTTACAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 58, 3: 419, 4: 2506} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!