ID: 916365964_916365972

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 916365964 916365972
Species Human (GRCh38) Human (GRCh38)
Location 1:164028050-164028072 1:164028089-164028111
Sequence CCCAGTAGCAGACCAAGAGCTGT AGTTATCTGTGGAGGAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 49, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!