ID: 916425928_916425929

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 916425928 916425929
Species Human (GRCh38) Human (GRCh38)
Location 1:164679748-164679770 1:164679800-164679822
Sequence CCTGTGAGTAGCACTATAGGTTT TTATAACTACCCTGTGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62} {0: 1, 1: 0, 2: 5, 3: 83, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!