ID: 916432429_916432432

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 916432429 916432432
Species Human (GRCh38) Human (GRCh38)
Location 1:164743975-164743997 1:164744004-164744026
Sequence CCAAGGAGGAAAGGTAGAATGGA CTAGGTAACTAGAAGTCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 332} {0: 1, 1: 0, 2: 1, 3: 4, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!