ID: 916480554_916480558

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 916480554 916480558
Species Human (GRCh38) Human (GRCh38)
Location 1:165210761-165210783 1:165210800-165210822
Sequence CCAGAGTCTCTCTCACCTTGGAA GTAGACACACTGGCATCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 228} {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!