ID: 916486034_916486037

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 916486034 916486037
Species Human (GRCh38) Human (GRCh38)
Location 1:165259479-165259501 1:165259516-165259538
Sequence CCCACATCATTTTGGTTCTCATA AGAGGCTGCTGACTATTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 219} {0: 1, 1: 0, 2: 1, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!