ID: 916489508_916489516

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 916489508 916489516
Species Human (GRCh38) Human (GRCh38)
Location 1:165289055-165289077 1:165289087-165289109
Sequence CCCACACCAGAGACTCCAGCCTC TGCCTTCATCTAATCTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 292} {0: 1, 1: 0, 2: 0, 3: 24, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!