ID: 916532714_916532719

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 916532714 916532719
Species Human (GRCh38) Human (GRCh38)
Location 1:165673504-165673526 1:165673520-165673542
Sequence CCCTTTGCAGTAACATCTTTCTG CTTTCTGGCAAACCATGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 49, 3: 103, 4: 355} {0: 3, 1: 5, 2: 5, 3: 24, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!