ID: 916533509_916533514

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 916533509 916533514
Species Human (GRCh38) Human (GRCh38)
Location 1:165680864-165680886 1:165680897-165680919
Sequence CCCGAAACTGGGAACAGAAAGAG ATTTACAGTTCCACATGGCTAGG
Strand - +
Off-target summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} {0: 101, 1: 2363, 2: 6344, 3: 7328, 4: 7535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!