ID: 916533509_916533518

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 916533509 916533518
Species Human (GRCh38) Human (GRCh38)
Location 1:165680864-165680886 1:165680915-165680937
Sequence CCCGAAACTGGGAACAGAAAGAG CTAGGGAGGCCTCAGAATCATGG
Strand - +
Off-target summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} {0: 66, 1: 1345, 2: 6052, 3: 6496, 4: 3963}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!