ID: 916549223_916549227

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 916549223 916549227
Species Human (GRCh38) Human (GRCh38)
Location 1:165833328-165833350 1:165833347-165833369
Sequence CCAGACCCACTCTTGGCATGGCA GGCAGGCTTTCCCCCAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118} {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!