ID: 916616450_916616459

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 916616450 916616459
Species Human (GRCh38) Human (GRCh38)
Location 1:166446250-166446272 1:166446287-166446309
Sequence CCCAATCATCTTATCCCAATATC TATCTAAATATCATCACATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!