ID: 916640094_916640103

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 916640094 916640103
Species Human (GRCh38) Human (GRCh38)
Location 1:166718108-166718130 1:166718137-166718159
Sequence CCTCCAGACCTCAACCTTTCCAA TGCCCTCAGCAGAGGTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 33, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!