ID: 916651678_916651690

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 916651678 916651690
Species Human (GRCh38) Human (GRCh38)
Location 1:166839645-166839667 1:166839663-166839685
Sequence CCCCCGGGTCCCGGGCGGCTGGG CTGGGCCGCGGCAGAGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 473} {0: 1, 1: 0, 2: 10, 3: 78, 4: 702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!