ID: 916651695_916651711

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 916651695 916651711
Species Human (GRCh38) Human (GRCh38)
Location 1:166839702-166839724 1:166839730-166839752
Sequence CCGCCGCCGCCGCCTTTGTTGCG GCCGGGGAGGCGGGCGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 248} {0: 1, 1: 0, 2: 20, 3: 200, 4: 1316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!