ID: 916651943_916651946

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 916651943 916651946
Species Human (GRCh38) Human (GRCh38)
Location 1:166840837-166840859 1:166840877-166840899
Sequence CCAGCGGGAACAGTGCTTGGGGC GGCTCAGCCTCCCCCATCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113} {0: 1, 1: 0, 2: 2, 3: 23, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!