ID: 916660733_916660744

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 916660733 916660744
Species Human (GRCh38) Human (GRCh38)
Location 1:166920724-166920746 1:166920763-166920785
Sequence CCTTTTTCCTCTTCTTCTCCGAG GGTCGCGGCCGCGGTAGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 519} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!