ID: 916667688_916667694

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 916667688 916667694
Species Human (GRCh38) Human (GRCh38)
Location 1:166981448-166981470 1:166981483-166981505
Sequence CCTTATGTCAAATAGCTTACATT ATGTGTGTAGAGAGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 239} {0: 1, 1: 0, 2: 21, 3: 149, 4: 1095}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!