|
Left Crispr |
Right Crispr |
| Crispr ID |
916677323 |
916677331 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:167074983-167075005
|
1:167075015-167075037
|
| Sequence |
CCTCCTCCCGCCAGGTTCAAGTG |
CCTCAGCCTCCCGAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 11, 2: 614, 3: 15176, 4: 52503} |
{0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|