ID: 916712884_916712894

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 916712884 916712894
Species Human (GRCh38) Human (GRCh38)
Location 1:167427543-167427565 1:167427579-167427601
Sequence CCCTCCCAGACCCTCAGTGTGGT GAGTAGCAGTAGTCTCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!