|
Left Crispr |
Right Crispr |
| Crispr ID |
916728559 |
916728565 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:167545629-167545651
|
1:167545650-167545672
|
| Sequence |
CCACCCTCTTTATGAAAATACAA |
AAAAAATCAGCTGGGTGTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 3, 3: 65, 4: 596} |
{0: 249, 1: 10867, 2: 58100, 3: 132101, 4: 201835} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|